Sequence ID | >WENV170001183 |
Genome ID | AGBK01000476 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 124 |
End posion on genome | 35 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
taactttctc |
tRNA gene sequence |
GGAGGGGTGGGCGAGTGGACAAAACCGCCGGTCTTGAAAACCGGAGAGCCTATCCTGGCT |
Downstream region at tRNA end position |
gctatcaatt |
Secondary structure (Cloverleaf model) | >WENV170001183 Ser TGA c GCCA gctatcaatt G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A T G A G | | | | | G G G C G G G T G G G C G | | T T A A A C C C A A G AGAGCCTATCCTGGCTCC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |