Sequence ID | >WENV170001185 |
Genome ID | AGBK01000570 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1913 |
End posion on genome | 1840 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tgtagtttaa |
tRNA gene sequence |
TGGGAGATCGTCTAATGGTAGGACGGCGGGTTCTGGACCCGTTAGTGGAGGTTCGAATCC |
Downstream region at tRNA end position |
gacatggtcc |
Secondary structure (Cloverleaf model) | >WENV170001185 Gln CTG a GCCA gacatggtcc T - A G - C G - C G - C A - T G - C A - T T A T C C T C C A A A C | | | | | G T T C T G G G A G G C G + | | | T T G G G A C T A G TAGT G + T C - G G - C G - C G - C T A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |