Sequence ID | >WENV170001188 |
Genome ID | AGBK01000682 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 373 |
End posion on genome | 286 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttaatcccgg |
tRNA gene sequence |
GCCGGGGTGGCAGAATTTGGCAATGCGCCGGCTTTGAGAGCCGGTGGCCGTTATGGCCTT |
Downstream region at tRNA end position |
aggtgattca |
Secondary structure (Cloverleaf model) | >WENV170001188 Ser TGA g GTCA aggtgattca G - C C - G C - G G - C G - C G - C G - C T A T G A C C C A T A A G | | | | | A T G A C G C T G G G C T | | | T T G A T G C G C A G TGGCCGTTATGGCCTT C - G C - G G - C G - C C - G T A T G T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |