Sequence ID | >WENV170001190 |
Genome ID | AGBK01000730 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 151 |
End posion on genome | 63 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttaatctcca |
tRNA gene sequence |
GCCAGGGTGGCGGAATTGGCAGACGCGCGGGACTCAAAATCCCGTGGTCCGTTTGGGCCG |
Downstream region at tRNA end position |
ggattatatt |
Secondary structure (Cloverleaf model) | >WENV170001190 Leu CAA a ACCA ggattatatt G - C C - G C - G A - T G + T G - C G - C T C T C G C C C A T A A G | | | | | G T G G C G G C G G G C G | | | T T G A C G C C A G G TGGTCCGTTTGGGCCGT C - G G - C G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |