Sequence ID | >WENV170001192 |
Genome ID | AGBK01000745 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 245 |
End posion on genome | 319 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
attatcttgg |
tRNA gene sequence |
GCGGCCGTGGTCCAGTCCGGCTAAGACTCTGGCTTCCCATGCCAGCTACGCGGGTTCGAA |
Downstream region at tRNA end position |
actaagacat |
Secondary structure (Cloverleaf model) | >WENV170001192 Gly CCC g ACtc actaagacat G - C C - G G - C G - C C - G C - G G - C T A T C G C C C A C T G A G | | | | | G C C C T G G C G G G C G | | | T T G A G A C C T A T CTAC C - G T - A G - C G - C C - G T T T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |