Sequence ID | >WENV170001193 |
Genome ID | AGBK01000762 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 265 |
End posion on genome | 192 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tgattcagat |
tRNA gene sequence |
GGCGGCGTAGCCAAGGGGCCCAAGGCAGGGGATTGCAAATCCCCCATCCTCGGTTCAAAT |
Downstream region at tRNA end position |
gaccagacaa |
Secondary structure (Cloverleaf model) | >WENV170001193 Cys GCA t TCac gaccagacaa G - C G - C C - G G - C G + T C - G G - C T A T G A G C C A G G A A | | | | | A G A C C G C T C G G C G | | | T T C A G G C C C A A CATC G - C G - C G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |