Sequence ID | >WENV170001198 |
Genome ID | AGBK01000803 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1553 |
End posion on genome | 1627 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttgtgctct |
tRNA gene sequence |
GGGTCCATAGCTCAGCGGTAGAGCATCCGGCTCATAACCGGGCGGTCCTAGGTTCAAATC |
Downstream region at tRNA end position |
gaattttttg |
Secondary structure (Cloverleaf model) | >WENV170001198 Met CAT t ACCA gaattttttg G - C G - C G - C T + G C - G C - G A - T T A T G A T C C A G A A | | | | | A C C T C G C T A G G C G | | | | T T G G A G C T A A CGGTC T + G C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |