Sequence ID | >WENV170001200 |
Genome ID | AGBK01000807 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1323 |
End posion on genome | 1396 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ggctctcata |
tRNA gene sequence |
GGGCCCGTAGCTCAGTTGGTACGAGCGCCGCCTTTGCAAGGCGGAGGTCCCGGGTTCAAA |
Downstream region at tRNA end position |
tacatgcagc |
Secondary structure (Cloverleaf model) | >WENV170001200 Ala TGC a Attt tacatgcagc G - C G - C G + T C - G C - G C - G G + T T A T G G C C C A T G A A | | | | | A T C T C G C C G G G C G | | | | T T G G A G C T A C G AGGTC C - G C - G G - C C - G C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |