Sequence ID | >WENV170001206 |
Genome ID | AGBK01001382 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 157 |
End posion on genome | 229 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
taaaagagat |
tRNA gene sequence |
GGGCGAATGGCTCAGCGGTAGAGCGCCTGATTCACATTCAGGAGGTCGCAGGTTCGAACC |
Downstream region at tRNA end position |
ctcttttttt |
Secondary structure (Cloverleaf model) | >WENV170001206 Val CAC t ACtt ctcttttttt G - C G - C G - C C - G G - C A - T A - T C A T C G T C C A G A G | | | | | G C C T C G G C A G G C G | | | | T T G G A G C T A G AGGTC C - G C - G T - A G - C A - T T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |