Sequence ID | >WENV170001207 |
Genome ID | AGBK01001505 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 390 |
End posion on genome | 474 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gttcaaatga |
tRNA gene sequence |
GCCGGGGTGGCAGAATCTGGTATTGCGCCGGATTCGAGATCCGGTAGCCTCACGGCTTTC |
Downstream region at tRNA end position |
tctttatcat |
Secondary structure (Cloverleaf model) | >WENV170001207 Ser CGA a GCtt tctttatcat G - C C - G C - G G - C G - C G - C G - C T A T G A C C C A T A A G | | | | | A C G A C G C T G G G C T + | | | T T G T T G C G T A G TAGCCTCACGGCTTT C - G C - G G - C G - C A - T T A T G C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |