Sequence ID | >WENV170001209 |
Genome ID | AGBK01001619 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 630 |
End posion on genome | 555 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
gtcatttcgt |
tRNA gene sequence |
GCGCCCGTAGCTCAGTCCGGTTAGAGCACCTACCTTATAAGTAGAAGGTCCCTGGTTCAA |
Downstream region at tRNA end position |
tcaccttaaa |
Secondary structure (Cloverleaf model) | >WENV170001209 Ile TAT t ACat tcaccttaaa G - C C - G G - C C - G C - G C - G G + T T T T G G A C C A C T G A A | | | | | A C C T C G C C T G G C G | | | | T T G G A G C T T A A AGGTC C A C - G T - A A - T C - G C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |