Sequence ID | >WENV170001212 |
Genome ID | AGBK01002049 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 348 |
End posion on genome | 273 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tagtttttac |
tRNA gene sequence |
AGGCCCGTAGCTCAACTGGCAGAGCGCCGGACTCCAAATCCGAAGGTTGGGGGTTCAACT |
Downstream region at tRNA end position |
gatgcactat |
Secondary structure (Cloverleaf model) | >WENV170001212 Trp CCA c GCCA gatgcactat A - T G - C G - C C - G C - G C - G G - C T C T C C T C C A C A A A | | + | | A T C T C G G G G G G C G | | | | T T G G A G C C A G AGGTT C A C - G G - C G - C A - T C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |