Sequence ID | >WENV170001213 |
Genome ID | AGBK01002109 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1025 |
End posion on genome | 935 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ttaatctgta |
tRNA gene sequence |
GGGGCGGTAGTCTAGCTAGGTTTAAGACACCAGCTTCGGGACTTGTCGGCGGAAAAGCTG |
Downstream region at tRNA end position |
cacattttgt |
Secondary structure (Cloverleaf model) | >WENV170001213 Pro CGG a Attc cacattttgt G - C G - C G - C G - C C - G G - C G - C T A T G C C C C A T C G A A | | | | | G A T C T G C G G G G C G | | | | T T G A G A C T T T A A CGGCGGAAAAGCTGGAGATC C T C - G A - T G + T C C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |