Sequence ID | >WENV170001215 |
Genome ID | AGBK01002413 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 394 |
End posion on genome | 465 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gttaaatcaa |
tRNA gene sequence |
GCGGGCGTGGTCTAGTGGCTATGACTCTGGCCTTCCAAGCCAGCAACGCGGGTTCGAGTC |
Downstream region at tRNA end position |
agagtttttg |
Secondary structure (Cloverleaf model) | >WENV170001215 Gly TCC a Ataa agagtttttg G - C C - G G + T G - C G - C C - G G - C T G T C G C C C A T G A G | | | | | G G T C T G G C G G G C G | | | T T C T G A C T A T CAAC C - G T - A G - C G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |