Sequence ID | >WENV170001218 |
Genome ID | AGBK01002533 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 737 |
End posion on genome | 828 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgtgttgccc |
tRNA gene sequence |
GGAGGGGTGGTCGAGTGGCCGAAGACGACGGCTTGCTAAGCCGTTGCTGAGGTGAAACTC |
Downstream region at tRNA end position |
actaaacttt |
Secondary structure (Cloverleaf model) | >WENV170001218 Ser GCT c GCCA actaaacttt G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A T G A G | | | | G G G C T G G C G G G C G | | | T T C A G A C C G A G TGCTGAGGTGAAACTCAGCC A - T C - G G - C G - C C - G T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |