Sequence ID | >WENV170001220 |
Genome ID | AGBK01002700 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 467 |
End posion on genome | 555 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
acgtacacat |
tRNA gene sequence |
GGAGGGGTGACCGAATCTGGCAAGGAGCCGGTCTCGAAAACCGGTAAGGCCGTATGGCCC |
Downstream region at tRNA end position |
aaactcgcgc |
Secondary structure (Cloverleaf model) | >WENV170001220 Ser CGA t GCCA aaactcgcgc G - C G - C A - T G - C G - C G + T G - C T G T C A C C C A T A A G | | | | | G C G C C A G T G G G C T | | T T G A G G A G C A G TAAGGCCGTATGGCCCT C - G C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |