Sequence ID | >WENV170001221 |
Genome ID | AGBK01002700 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 562 |
End posion on genome | 638 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
gccaaaactc |
tRNA gene sequence |
GCGCCCGTAGCTCAGTGGATGAGAGCGACGGATTGCGGATCCGTAGGTCGGGGGTTCAAA |
Downstream region at tRNA end position |
gattcaattc |
Secondary structure (Cloverleaf model) | >WENV170001221 Arg GCG c ACCA gattcaattc G + T C - G G - C C - G C - G C - G G - C T A T C C T C C A T G A A | | + | | A G C T C G G G G G G C G | | | | T T A G A G C T G A G AGGTC A - T C - G G - C G - C A - T T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |