Sequence ID | >WENV170001222 |
Genome ID | AGBK01002717 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 512 |
End posion on genome | 425 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acctagaatt |
tRNA gene sequence |
GCGGGGGTTGCCGAGCCAGGCCAAAGGCGAAGGACTCAAGATCCTTTCCCGTAGGGGTCC |
Downstream region at tRNA end position |
ttttcaggaa |
Secondary structure (Cloverleaf model) | >WENV170001222 Leu CAA t ACCA ttttcaggaa G - C C - G G - C G - C G - C G - C G - C T A T C T C C C A C C G A T | | | | | A A G C C G G A G G G C G | | | T T G A G G C C C A A G TCCCGTAGGGGTCC A - T A - T G - C G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |