Sequence ID | >WENV170001223 |
Genome ID | AGBK01002789 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 574 |
End posion on genome | 502 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tttacgtatg |
tRNA gene sequence |
GCCGGGATAGTGTAGCGGTTAGCACGAGGGCCTGTGGAGCCCTTAGGCCGGGTTCGAATC |
Downstream region at tRNA end position |
ttcttcctta |
Secondary structure (Cloverleaf model) | >WENV170001223 His GTG g CCtt ttcttcctta G - C C - G C - G G - C G - C G - C A - T T A T G G C T C A C G A A | | | + | G G T G T G C C G G G C G + | | | T T T G C A C T A G TAGG A - T G - C G - C G - C C - G C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |