Sequence ID | >WENV170001224 |
Genome ID | AGBK01002830 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 358 |
End posion on genome | 448 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cggaataagt |
tRNA gene sequence |
GGAGGGGTGCCAGAGTCCGGCCCATTGGAATAGCTTGGAGTGCTATGGTCTCTTTTGAGG |
Downstream region at tRNA end position |
caaattatgc |
Secondary structure (Cloverleaf model) | >WENV170001224 Ser GGA t GCCA caaattatgc G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A C T G A G | | | | | G C G A C C G T G G G C G + | | | T T G T T G G C C C A A GGTCTCTTTTGAGGCCC A - T T - A A - T G - C C - G T T T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |