Sequence ID | >WENV170001226 |
Genome ID | AGBK01002877 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 472 |
End posion on genome | 399 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tccttcttgt |
tRNA gene sequence |
GCCGAGGTGGCCGAGTCGGTTTTAGGCGGGCGGCTGCAGACCGCCTCACGTTGGTTCAAA |
Downstream region at tRNA end position |
ctaccgcggt |
Secondary structure (Cloverleaf model) | >WENV170001226 Cys GCA t Ttta ctaccgcggt G - C C - G C - G G - C A C G - C G - C T A T C A G C C A C T G A G | | + | | A G G C C G G T T G G C G | | | T T T A G G C T T T G TCAC G - C G - C C - G G - C G - C C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |