Sequence ID | >WENV170001230 |
Genome ID | AGBK01003470 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 624 |
End posion on genome | 698 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
taaaagagtt |
tRNA gene sequence |
GCCGAGGTAGCTCAGTTGGCAGAGCAACTTCTTCGTAAGAAGTAGGTCGGGGGGTTCAAA |
Downstream region at tRNA end position |
ttgagaacta |
Secondary structure (Cloverleaf model) | >WENV170001230 Thr CGT t TCag ttgagaacta G - C C - G C - G G - C A - T G - C G - C T A T T C T C C A T G A A + | + | | A T C T C G G G G G G C G | | | | T T G G A G C C A A AGGTCG A - T C - G T - A T - A C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |