Sequence ID | >WENV170001231 |
Genome ID | AGBK01003594 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 33 |
End posion on genome | 107 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ttttgtaatt |
tRNA gene sequence |
GCGGGCATAGCTCAGTGGTAGAGCGACAGCTTCCCATGCTGTAAGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
gaatgaataa |
Secondary structure (Cloverleaf model) | >WENV170001231 Gly CCC t TCTA gaatgaataa G - C C - G G - C G - C G - C C - G A - T T A T T G C C C A G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A G AAGTC A - T C - G A - T G - C C - G T T T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |