Sequence ID | >WENV170001232 |
Genome ID | AGBK01003729 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 123 |
End posion on genome | 50 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tatctgaagt |
tRNA gene sequence |
GCCCCGGTAGCTCAGTTGGCCAGAGCGATCGCCTCGTAAGCGATAGGTCGCGGGTTCGAA |
Downstream region at tRNA end position |
attgggtatt |
Secondary structure (Cloverleaf model) | >WENV170001232 Thr CGT t Tttg attgggtatt G - C C - G C - G C - G C - G G - C G - C T A T C G C C C A T G A A | | | | | G T C T C G G C G G G C G | | | | T T G G A G C C C A G AGGTC A - T T - A C - G G - C C - G C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |