| Sequence ID | >WENV170001233 |
| Genome ID | AGBK01004040 |
| Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
| Species | |
| Start position on genome | 35 |
| End posion on genome | 110 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
tcctcctcat |
| tRNA gene sequence |
GCCGGGGTGGCCGAGTCGGTTTAGGCGGGCGGCTGCAGACCGCCTCACGTCGGTTCGAAT |
| Downstream region at tRNA end position |
ctaccgtggc |
| Secondary structure (Cloverleaf model) | >WENV170001233 Cys GCA
t TCCA ctaccgtggc
G - C
C - G
C - G
G - C
G + T
G - C
G - C T A
T C A G C C A
T G A G | | | | | G
C G C C G G T C G G C
G | | | T T
G A G G C
T T T G TCAC
G - C
G - C
C - G
G - C
G - C
C A
T G
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |