Sequence ID | >WENV170001233 |
Genome ID | AGBK01004040 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 35 |
End posion on genome | 110 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tcctcctcat |
tRNA gene sequence |
GCCGGGGTGGCCGAGTCGGTTTAGGCGGGCGGCTGCAGACCGCCTCACGTCGGTTCGAAT |
Downstream region at tRNA end position |
ctaccgtggc |
Secondary structure (Cloverleaf model) | >WENV170001233 Cys GCA t TCCA ctaccgtggc G - C C - G C - G G - C G + T G - C G - C T A T C A G C C A T G A G | | | | | G C G C C G G T C G G C G | | | T T G A G G C T T T G TCAC G - C G - C C - G G - C G - C C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |