Sequence ID | >WENV170001239 |
Genome ID | AGBK01004574 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 56 |
End posion on genome | 130 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tacttacttg |
tRNA gene sequence |
AGGAGCGTAGCTCAAAGGTAGAGCACTGGGTTGTGGTCCCAGTTGTTGCGGGTTCGATTC |
Downstream region at tRNA end position |
cttgcgcccg |
Secondary structure (Cloverleaf model) | >WENV170001239 His GTG g CCCA cttgcgcccg A - T G - C G - C A - T G - C C - G G - C T T T T G C C C A A A A + | | | | G A C T C G G C G G G C G | | | | T T G G A G C T A A TTGTT C - G T - A G - C G - C G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |