Sequence ID | >WENV170001241 |
Genome ID | AGBK01004597 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 464 |
End posion on genome | 390 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ctccggcttt |
tRNA gene sequence |
GGGGGCGTAGCTCAGTCCGGCCAGAGCGGACGGCTGTAGACCGTCTTGTCGCCAGTTCGA |
Downstream region at tRNA end position |
aaccttcttt |
Secondary structure (Cloverleaf model) | >WENV170001241 Tyr GTA t Ctct aaccttcttt G A G - C G - C G - C G - C C - G G - C T T T C G G C C A C T G A A | | | | G C C T C G G C C A G C G | | | | T T G G A G C C C A G TTGTC G - C A - T C - G G - C G - C C A T G G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |