Sequence ID | >WENV170001245 |
Genome ID | AGBK01005243 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 70 |
End posion on genome | 145 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
agattaacct |
tRNA gene sequence |
TCCCCGGTAGCTCAATTGGCAGAGCGACCGGCTGTTAACCGGTAGGTTGCTGGTTCGAGT |
Downstream region at tRNA end position |
atggttcacg |
Secondary structure (Cloverleaf model) | >WENV170001245 Asn GTT t GCCA atggttcacg T - A C - G C - G C - G C - G G - C G - C T G T C G A C C A T A A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C C A G AGGTT A - T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |