Sequence ID | >WENV170001246 |
Genome ID | AGBK01005315 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 242 |
End posion on genome | 152 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gccataacaT |
tRNA gene sequence |
GCCGGGGTGGCCCAGTCTGGTAACGGCGCTAGCTTGCTAAGCTAGTTGCGTGAGAGCGCT |
Downstream region at tRNA end position |
tgatcacgca |
Secondary structure (Cloverleaf model) | >WENV170001246 Ser GCT T GTCA tgatcacgca G - C C - G C - G G - C G - C G - C G - C T A T G A C C C A C T G A G | | | | | G T C C C G C T G G G C G | | | T T G C G G C T A A G TTGCGTGAGAGCGCTTC C - G T - A A - T G - C C - G T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |