Sequence ID | >WENV170001247 |
Genome ID | AGBK01005315 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 76 |
End posion on genome | 3 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gacttgcttt |
tRNA gene sequence |
GGGCCCGTAGTCTAGTGGCTATGACGTCACCCTTACAAGGTGAAGGCCGAGGGTTCGAAT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170001247 Val TAC t ACtc nnnnnnnnnn G - C G - C G - C C - G C - G C - G G - C T A T C T C C C A T G A A | | | | | G G T C T G G A G G G C G | | | T T C T G A C T A G AGGCC T - A C - G A - T C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |