Sequence ID | >WENV170001249 |
Genome ID | AGBK01005357 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 496 |
End posion on genome | 569 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
atgagattaa |
tRNA gene sequence |
GGGTCCGTGGTCTAGTGGCTATGACGTCGCCTTCACATGGCGAAGGGCGAGGGTTCAAAT |
Downstream region at tRNA end position |
tctctaggat |
Secondary structure (Cloverleaf model) | >WENV170001249 Val CAC a ACtt tctctaggat G - C G - C G - C T - A C - G C - G G - C T A T C T C C C A T G A G | | | | | A G T C T G G A G G G C G | | | T T C T G A C T A G AGGGC T - A C - G G - C C - G C - G T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |