Sequence ID | >WENV170001252 |
Genome ID | AGBK01006225 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 481 |
End posion on genome | 558 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
gaattttcaT |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGCGGCCTTGCGGAGGCCGAGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170001252 Arg GCG T ACCC nnnnnnnnnn G - C C - G G - C C - G C - G C - G G - C T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A G AGGTC C - G G - C G - C C - G C - G T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |