Sequence ID | >WENV170001253 |
Genome ID | AGBK01006242 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 564 |
End posion on genome | 490 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GCGACCGTAGTCCAGTGGCTAAGACACCGGCTTGCCATGCCGGTAACCCGGGTTCAAATC |
Downstream region at tRNA end position |
tctctccacc |
Secondary structure (Cloverleaf model) | >WENV170001253 Gly GCC n ACCA tctctccacc G - C C - G G - C A - T C - G C - G G - C T A T G G C C C A T G A A | | | | | A G C C T G C C G G G C G | | | T T C A G A C T A A TAAC C - G C - G G - C G - C C - G T T T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |