Sequence ID | >WENV170001254 |
Genome ID | AGBK01006561 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 499 |
End posion on genome | 424 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agtactatgt |
tRNA gene sequence |
GCCAGGGTGGCCGAGTGGTTTTAGGTGGCGGATTGCAGATCCGCTTACGCCGGTTCAAAT |
Downstream region at tRNA end position |
ttcgaaaaaa |
Secondary structure (Cloverleaf model) | >WENV170001254 Cys GCA t TTCA ttcgaaaaaa G - C C - G C - G A - T G - C G - C G - C T A T C G G C C A T G A G | | | | | A G G C C G G C C G G C G | | + T T T A G G T T T T G TTAC G - C C - G G - C G - C A - T T A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |