Sequence ID | >WENV170001258 |
Genome ID | AGBK01006951 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 425 |
End posion on genome | 350 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ggatgcttga |
tRNA gene sequence |
GGGGACGTAGCTCAGTTGGGAGAGCGCCGCCTTCGCACGGCGGAGGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
ttataaaagg |
Secondary structure (Cloverleaf model) | >WENV170001258 Ala CGC a ACCA ttataaaagg G - C G - C G + T G - C A - T C - G G - C T G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C G A G AGGTC C - G C - G G - C C - G C - G T C T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |