Sequence ID | >WENV170001260 |
Genome ID | AGBK01006975 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 166 |
End posion on genome | 90 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gccactcgcT |
tRNA gene sequence |
AGCCCCGTAGAATAACAGGTAAAGTTCACCGGACTTTGAATCCGGAGGAAGAGGTTCGAT |
Downstream region at tRNA end position |
tgggggagta |
Secondary structure (Cloverleaf model) | >WENV170001260 Gln TTG T ATCg tgggggagta A - T G - C C - G C - G C - G C - G G - C T T T T T T C C A A C A A A | + | | | G G T A A G A G A G G C G + | | | T T T G T T C A A A A AGGA C - G C - G G - C G - C A - T C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |