Sequence ID | >WENV170001261 |
Genome ID | AGBK01007088 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 96 |
End posion on genome | 174 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ctctccgcat |
tRNA gene sequence |
GCCTCGGTAGCTAAGCTCGGTTCAAAGCGACCGGTTCGTAACCGGTAGGGCGAGGGTTCG |
Downstream region at tRNA end position |
ctcgtgcgag |
Secondary structure (Cloverleaf model) | >WENV170001261 Thr CGT t TCCA ctcgtgcgag G - C C - G C - G T - A C - G G - C G - C T A T C T C C C A T C G A A | | | | | G C A T C G G A G G G C G | | | T T G A A G C T T C A G AGGGC A - T C - G C - G G - C G - C T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |