Sequence ID | >WENV170001263 |
Genome ID | AGBK01007139 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 228 |
End posion on genome | 303 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aagctcttct |
tRNA gene sequence |
GAAGGCGTGGCCTAGCCTGGACAGGGCAGAAGGTTTCTAACCTTCCGATCGGCGGTTCGA |
Downstream region at tRNA end position |
gtagccctgt |
Secondary structure (Cloverleaf model) | >WENV170001263 Arg TCT t GCtc gtagccctgt G - C A C A - T G - C G - C C - G G - C T A T C T G C C A C C G A G | + | | | G T T C C G G G C G G C G + | | | T T G G G G C A C A A CGATC G - C A - T A - T G - C G - C T A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |