Sequence ID | >WENV170001264 |
Genome ID | AGBK01007216 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 377 |
End posion on genome | 304 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tattcaatct |
tRNA gene sequence |
GCCCCGATGGTGTAGTGGCCTATCATTCGAGCCTGTCACGCTCGGGACGCGGGTTCGACT |
Downstream region at tRNA end position |
ggcagttcgt |
Secondary structure (Cloverleaf model) | >WENV170001264 Asp GTC t GCtc ggcagttcgt G - C C - G C - G C - G C - G G - C A - T T C T C G C C C A T G A G | | | | | G G T G T G G C G G G C G | | + T T C T C A T C T A T GGAC C - G G - C A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |