Sequence ID | >WENV170001265 |
Genome ID | AGBK01007332 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 474 |
End posion on genome | 399 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
nnnntttcgt |
tRNA gene sequence |
GCCTTGGTGGCCTAACAGGTATGGCAGCCGGCTGTTGACCGGAAGATTGACGGTTCGAAT |
Downstream region at tRNA end position |
ctttttgccc |
Secondary structure (Cloverleaf model) | >WENV170001265 Asn GTT t GCTA ctttttgccc G - C C - G C - G T + G T + G G - C G - C T A T C T G C C A C A A G | | | | | G A T C C G G A C G G C G | | | T T G T G G C T A A AGATT G A C - G C - G G - C G - C C A T G G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |