| Sequence ID | >WENV170001265 |
| Genome ID | AGBK01007332 |
| Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
| Species | |
| Start position on genome | 474 |
| End posion on genome | 399 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
nnnntttcgt |
| tRNA gene sequence |
GCCTTGGTGGCCTAACAGGTATGGCAGCCGGCTGTTGACCGGAAGATTGACGGTTCGAAT |
| Downstream region at tRNA end position |
ctttttgccc |
| Secondary structure (Cloverleaf model) | >WENV170001265 Asn GTT
t GCTA ctttttgccc
G - C
C - G
C - G
T + G
T + G
G - C
G - C T A
T C T G C C A
C A A G | | | | | G
A T C C G G A C G G C
G | | | T T
G T G G C
T A A AGATT
G A
C - G
C - G
G - C
G - C
C A
T G
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |