Sequence ID | >WENV170001266 |
Genome ID | AGBK01007332 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 392 |
End posion on genome | 308 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gctacttttt |
tRNA gene sequence |
GCCCGGGTGGCAGAACGGTATTGCGCCAGCTTGGAGAGCTGGTCTCCGAGAGGGGTTAGC |
Downstream region at tRNA end position |
tatccacttt |
Secondary structure (Cloverleaf model) | >WENV170001266 Ser GGA t GCCA tatccacttt G - C C - G C - G C - G G - C G - C G - C T G T T C G C C A A A G | | | | | G C G A C G A G C G G C G + | | | T T G T T G C T A G TCTCCGAGAGGGGTT C - G C - G A - T G - C C - G T A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |