Sequence ID | >WENV170001273 |
Genome ID | AGBK01008629 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 288 |
End posion on genome | 363 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gggaatatca |
tRNA gene sequence |
GGGCCCGTGGTCTAGTGGCTATGACGTCGCCTTCACGAGGCGAAGGTCGAGGGTTCGACC |
Downstream region at tRNA end position |
ctgattttta |
Secondary structure (Cloverleaf model) | >WENV170001273 Val CAC a ACCA ctgattttta G - C G - C G - C C - G C - G C - G G - C C C T C T C C C A T G A G | | | | | G G T C T G G A G G G C G | | | T T C T G A C T A G AGGTC T - A C - G G - C C - G C - G T A T G C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |