Sequence ID | >WENV170001275 |
Genome ID | AGBK01008712 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 322 |
End posion on genome | 246 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
atcctgacat |
tRNA gene sequence |
GCGCCTGTAGCTCAGTAGGATAGAGCGATGGATTCCTAATCCATAGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
atagaaaaaa |
Secondary structure (Cloverleaf model) | >WENV170001275 Arg CCT t ACCA atagaaaaaa G - C C - G G - C C - G C - G T + G G - C T A T C C T C C A T G A A | | + | | G A C T C G G G G G G C G | | | | T T G G A G C A T A G AGGTC A - T T - A G - C G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |