Sequence ID | >WENV170001277 |
Genome ID | AGBK01008867 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 193 |
End posion on genome | 265 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
taactgagtT |
tRNA gene sequence |
GCGTGAGTAGTCCAGTGGCAGAATACTTGCTTCCCAAGCAAGTGACCCGGGTTCGAATCC |
Downstream region at tRNA end position |
ctttcttttt |
Secondary structure (Cloverleaf model) | >WENV170001277 Gly CCC T ATgt ctttcttttt G - C C - G G - C T + G G - C A - T G - C T A T G G C C C A G A A | | | | | G T C C T G C C G G G C G | | + T T G G A A T C A A TGAC C - G T - A T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |