Sequence ID | >WENV170001280 |
Genome ID | AGBK01009192 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 156 |
End posion on genome | 232 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ctagtaagat |
tRNA gene sequence |
CGGGACGTGGCGCAGCTTGGTAGCGCGCGCGCATGGGGCGCGCGAAGTCGCTGGTTCAAA |
Downstream region at tRNA end position |
aaaatgagct |
Secondary structure (Cloverleaf model) | >WENV170001280 Pro GGG t ACCA aaaatgagct C - G G - C G - C G - C A - T C - G G - C T A T T G A C C A C G A G + | | | | A T C G C G G C T G G C T | | | | T T G G C G C G T A G AAGTC C - G G - C C - G G - C C - G A C T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |