Sequence ID | >WENV170001283 |
Genome ID | AGBK01009503 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 322 |
End posion on genome | 245 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aataacattc |
tRNA gene sequence |
GCCGGGGTGGCCGAGTCTGGCTTCAGGCGGCGGACTGCAGATCCGCTCACGTCGGTTCAA |
Downstream region at tRNA end position |
ttactctccc |
Secondary structure (Cloverleaf model) | >WENV170001283 Cys GCA c TCTA ttactctccc G - C C - G C A G - C G - C G - C G - C T G T C A G C C A C T G A G | | | | | A T G C C G G T C G G C G | | | T T G A G G C C T T C G TCAC G - C C - G G - C G - C A - T C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |