Sequence ID | >WENV170001284 |
Genome ID | AGBK01009630 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 116 |
End posion on genome | 193 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
caataacaca |
tRNA gene sequence |
GGGCCCGTAGCTCAGTCTGGCGAGAGCAGTCGGCTCTTAACCGACCAGTCGTGGGTTCAA |
Downstream region at tRNA end position |
cacctcaggt |
Secondary structure (Cloverleaf model) | >WENV170001284 Lys CTT a GCCA cacctcaggt G - C G - C G - C C - G C - G C - G G + T T A T C A C C C A C T G A A | | | | | A T C T C G G T G G G C G | | | | T T G G A G C C G A A CAGTC G - C T - A C - G G - C G - C C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |