Sequence ID | >WENV170001287 |
Genome ID | AGBK01009895 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 322 |
End posion on genome | 245 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGGGCCGTGGGGTAGTCAGGACTAGCCTCCTACCATGGGGCGGTAGATACCCGAGTTCAA |
Downstream region at tRNA end position |
gactcctttc |
Secondary structure (Cloverleaf model) | >WENV170001287 Pro GGG n ACCA gactcctttc G - C G - C G - C G - C C - G C - G G - C T A T G G C T C A C T G A G | | | | | A A T G G G C C G A G C G + | | + T T G G C C T A C T A C ATAC C - G T - A A - T C - G C - G A C T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |