Sequence ID | >WENV170001288 |
Genome ID | AGBK01010106 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 156 |
End posion on genome | 82 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ttttgcgttt |
tRNA gene sequence |
GCCGGTGTAGCTCAGCGGTAGAGCGGCTGATTCGTAATCAGTTAGTCGGTGGTTCAAATC |
Downstream region at tRNA end position |
gtttacacca |
Secondary structure (Cloverleaf model) | >WENV170001288 Thr CGT t TCCA gtttacacca G - C C - G C - G G - C G - C T + G G - C T A T T C A C C A G A A + | | | | A C C T C G G G T G G C G | | | | T T G G A G C T A G TAGTC G + T C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |