Sequence ID | >WENV170001289 |
Genome ID | AGBK01010442 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 215 |
End posion on genome | 141 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ttctggtaga |
tRNA gene sequence |
GCGGTGGTAACTCAGGGGTAGAGTGCTTGCTTCCCAAGCAGGTTGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
cccattaaaa |
Secondary structure (Cloverleaf model) | >WENV170001289 Gly CCC a TCCT cccattaaaa G - C C - G G - C G - C T + G G - C G - C T A T T G C C C A G A A + | | | | G G C T C A G C G G G C G | | | | T T G G A G T T A G TTGTC C - G T + G T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |